BBa_J54031 1 BBa_J54031 PrefixII_SalI,BamHI 2006-10-14T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Restriction Enzyme site false false _76_ 0 762 76 Not in stock false As Prefix false Yusaku Nakashima annotation1903199 1 BamHI range1903199 1 32 36 annotation1903198 1 SalI range1903198 1 18 23 BBa_J54031_sequence 1 cgcggccgcttctagaggtcgactgacgactggatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z