BBa_J54110 1 BBa_J54110 MelR_regulated promoter 2006-10-20T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis promoter false false _76_ 0 762 76 Not in stock false as MelR promoter false Yusaku Nakashima annotation1903810 1 BamHI range1903810 1 1 5 annotation1903811 1 MelR_regulated promoter range1903811 1 6 74 BBa_J54110_sequence 1 gatccatctgagtttatgggaatgcattacctgaaaagcagaggttttctgcggattcgcctgccatgatgaagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z