BBa_J54130 1 BBa_J54130 BetI_regulated promoter 2006-10-20T11:00:00Z 2015-08-31T03:48:12Z DNA synthsis BetI_regulated promoter false false _76_ 0 762 76 Not in stock false As BetI regulated false Yusaku Nakashima annotation1903812 1 BetI_regulated promoter range1903812 1 6 43 annotation1903813 1 BamHI range1903813 1 1 5 BBa_J54130_sequence 1 gatccttatattgaacgtccaatcaataaccgctttaatagataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z