BBa_J54130 1 BBa_J54130 BetI_regulated promoter 2006-10-20T11:00:00Z 2015-08-31T03:48:12Z DNA synthsis BetI_regulated promoter false false _76_ 0 762 76 Not in stock false As BetI regulated false Yusaku Nakashima annotation1903812 1 BetI_regulated promoter range1903812 1 6 43 annotation1903813 1 BamHI range1903813 1 1 5 BBa_J54023 1 BBa_J54023 PrefixI_SalI 2006-10-15T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Resitriction Enzyme site false false _76_ 0 762 76 Not in stock false As Prefix false Yusaku Nakashima annotation1903320 1 Sal range1903320 1 1 5 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J54025 1 BBa_J54025 SuffixI_BglII,MluI 2006-10-15T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Restriction Enzyme site false false _76_ 0 762 76 Not in stock false As Suffix false Yusaku Nakashima annotation1903321 1 BglII range1903321 1 1 5 annotation1903322 1 MulI range1903322 1 14 19 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J54131 1 BBa_J54131 BetI_regulated_promoter-GFP(A-3) 2006-10-20T11:00:00Z 2015-08-31T03:48:12Z synthesis BetI_regulated_promoter-GFP(A-1) false false _76_ 0 762 76 Not in stock true As BetI regulated false Yusaku Nakashima component1903844 1 BBa_B0010 component1903846 1 BBa_B0012 component1903843 1 BBa_E0040 component1903836 1 BBa_J54130 component1903833 1 BBa_J54023 component1903839 1 BBa_J54025 component1903841 1 BBa_B0030 annotation1903843 1 BBa_E0040 range1903843 1 116 835 annotation1903841 1 BBa_B0030 range1903841 1 95 109 annotation1903844 1 BBa_B0010 range1903844 1 844 923 annotation1903833 1 BBa_J54023 range1903833 1 1 5 annotation1903839 1 BBa_J54025 range1903839 1 68 86 annotation1903836 1 BBa_J54130 range1903836 1 14 59 annotation1903846 1 BBa_B0012 range1903846 1 932 972 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J54130_sequence 1 gatccttatattgaacgtccaatcaataaccgctttaatagataaa BBa_J54025_sequence 1 gatctgtcggataacgcgt BBa_J54023_sequence 1 gtcga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J54131_sequence 1 gtcgatactagaggatccttatattgaacgtccaatcaataaccgctttaatagataaatactagaggatctgtcggataacgcgttactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z