BBa_J54210 1 BBa_J54210 RbsR_Binding_Site 2006-10-14T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis RbsR_Binding_Site false false _76_ 0 762 76 Not in stock false as regulator false Yusaku Nakashima annotation1903231 1 BglII range1903231 1 25 31 annotation1903232 1 RbsR_Binding_Site range1903232 1 6 24 BBa_J54210_sequence 1 gatcgtcagcgaaacgtttcgctgagatctatgcgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z