BBa_J54230 1 BBa_J54230 TetR_regulated 2006-10-21T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis TetR_binding_site false false _76_ 0 762 76 Not in stock false a false Yusaku Nakashima annotation1904014 1 TetR range1904014 1 1 25 annotation1904013 1 BglII range1904013 1 26 32 BBa_J54230_sequence 1 gatcgtccctatcagtgatagagatagatctatcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z