BBa_J54034 1 BBa_J54034 SuffixII_MluI 2006-10-15T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Restriction Enzyme site false false _76_ 0 762 76 Not in stock false As Suffix false Yusaku Nakashima annotation1903325 1 MulI range1903325 1 1 5 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_J54200 1 BBa_J54200 lacq_Promoter 2006-10-14T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis Promoter that express always. false false _76_ 0 762 76 Not in stock false As promoter false Yusaku Nakashima annotation1903215 1 lacq Promoter range1903215 1 14 48 annotation1903214 1 BamHI range1903214 1 7 13 BBa_J54230 1 BBa_J54230 TetR_regulated 2006-10-21T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis TetR_binding_site false false _76_ 0 762 76 Not in stock false a false Yusaku Nakashima annotation1904014 1 TetR range1904014 1 1 25 annotation1904013 1 BglII range1904013 1 26 32 BBa_J54232 1 BBa_J54232 TetR_regulated(B-3) 2006-10-21T11:00:00Z 2015-08-31T03:48:12Z BBa_J54202 a false false _76_ 0 762 76 Not in stock true a false Yusaku Nakashima component1904038 1 BBa_J54023 component1904044 1 BBa_J54230 component1904048 1 BBa_B0030 component1904041 1 BBa_J54200 component1904050 1 BBa_E0040 component1904053 1 BBa_B0012 component1904046 1 BBa_J54034 component1904051 1 BBa_B0010 annotation1904041 1 BBa_J54200 range1904041 1 14 63 annotation1904051 1 BBa_B0010 range1904051 1 880 959 annotation1904053 1 BBa_B0012 range1904053 1 968 1008 annotation1904046 1 BBa_J54034 range1904046 1 118 122 annotation1904038 1 BBa_J54023 range1904038 1 1 5 annotation1904044 1 BBa_J54230 range1904044 1 72 109 annotation1904048 1 BBa_B0030 range1904048 1 131 145 annotation1904050 1 BBa_E0040 range1904050 1 152 871 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J54023 1 BBa_J54023 PrefixI_SalI 2006-10-15T11:00:00Z 2015-08-31T03:48:11Z DNA synthesis Resitriction Enzyme site false false _76_ 0 762 76 Not in stock false As Prefix false Yusaku Nakashima annotation1903320 1 Sal range1903320 1 1 5 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_J54230_sequence 1 gatcgtccctatcagtgatagagatagatctatcgtaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J54200_sequence 1 ccgtgacggatcctggtgcaaaacctttcgcggtatggcatgatagcgcc BBa_J54232_sequence 1 gtcgatactagagccgtgacggatcctggtgcaaaacctttcgcggtatggcatgatagcgcctactagaggatcgtccctatcagtgatagagatagatctatcgtaatactagagcgcgttactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J54034_sequence 1 cgcgt BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J54023_sequence 1 gtcga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z