BBa_J54250 1 BBa_J54250 LacI_Binding_Site 2006-10-16T11:00:00Z 2015-08-31T03:48:12Z DNA synthesis LacI_binding_site false false _76_ 0 762 76 Not in stock false As Regulaor false Yusaku Nakashima annotation1903385 1 BglII range1903385 1 30 35 annotation1903384 1 LacI_Binding_Site range1903384 1 6 29 BBa_J54250_sequence 1 gatcggaattgtgagcggataacaattccagatctatcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z