BBa_J56015 1 BBa_J56015 lacIQ - promoter sequence 2006-10-31T12:00:00Z 2015-08-31T03:22:59Z Synthesized by DNA 2.0 Promoter sequence for constituitive expression false false _79_98_ 0 1132 98 Not in stock false None false Matt Eames BBa_J56015_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z