BBa_Q04400 1 tetR QPI (B0034.C0040.B0015.R0040) 2003-12-02T12:00:00Z 2015-05-08T01:14:13Z Released HQ 2013 TetR QPI with strong RBS false true _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff component952781 1 BBa_B0034 component952807 1 BBa_B0012 component952822 1 BBa_R0040 component952797 1 BBa_B0010 component952791 1 BBa_C0040 annotation952807 1 BBa_B0012 range952807 1 800 840 annotation952797 1 BBa_B0010 range952797 1 712 791 annotation952822 1 BBa_R0040 range952822 1 849 902 annotation952791 1 BBa_C0040 range952791 1 19 678 annotation952781 1 BBa_B0034 range952781 1 1 12 BBa_R0083 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000193 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is derived from the upstream region of ompC. Phosphorylated OmpR binds to the operator site and activates transcription. This is a truncated version of BBa_R0082. false false _1_ 0 24 7 In stock false The promoter deletes the C2 and C3 regions of BBa_R0082 (bases 37-74 in BBa_R0082) and inserts an 8-base linker before the -35 and -10 signal region. The efficacy of this promoter versus the full ompC upstream region (BBa_R0082) or the ompF upstream region (BBa_R0084) is currently unknown. The a at base 41 is mutated to t to avoid XbaI site. Speculation that this was a previous assembly site. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301224 1 -35 range301224 1 45 50 annotation301221 1 C1 OmpR range301221 1 13 30 annotation301226 1 -10 range301226 1 68 73 annotation306881 1 A range306881 1 41 41 annotation301223 1 linker range301223 1 37 44 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23329 1 tetR range23329 1 4 620 BBa_J58117 1 BBa_J58117 Mutated OmpR promoter with inverter TetR 2006-10-25T11:00:00Z 2015-08-31T02:06:24Z none none false false _83_ 0 1100 83 Not in stock false none false Valencia iGEM 2006 component2260329 1 BBa_R0083 component2260347 1 BBa_Q04400 annotation2260329 1 BBa_R0083 range2260329 1 1 78 annotation2260347 1 BBa_Q04400 range2260347 1 87 988 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J58117_sequence 1 tcccttgcatttacattttgaaacatctatagcgatctcttgagttggattattctgcatttttggggagaatggacttactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0034_sequence 1 aaagaggagaaa BBa_R0083_sequence 1 tcccttgcatttacattttgaaacatctatagcgatctcttgagttggattattctgcatttttggggagaatggact BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_Q04400_sequence 1 aaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z