BBa_J59002 1 BBa_J59002 sehnaz 2006-08-28T11:00:00Z 2015-08-31T02:02:59Z none sehnaz true false _93_ 0 1163 93 Discontinued false none false sehnaz ozatay annotation1898349 1 dna range1898349 1 1 35 BBa_J59002_sequence 1 ctttaggatctttaggatctttaggatctttaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z