BBa_J61028 1 BBa_J61028 [P_T7][Tn5-rev] 2006-09-20T11:00:00Z 2015-08-31T02:02:59Z standard biobrick assembly Intermediate false false _95_ 0 483 95 Not in stock false N/A false John Anderson component1902251 1 BBa_R0085 component1902252 1 BBa_J61022 annotation1902252 1 BBa_J61022 range1902252 1 32 50 annotation1902251 1 BBa_R0085 range1902251 1 1 23 BBa_J61022 1 Tn5R [Tn5-rev] 2006-09-20T11:00:00Z 2015-08-31T02:02:59Z Overlap extension of synthetic oligonucleotides DNA substrate for Tn5 transposase. Flanking a sequence with J61021 on the 5' end and J61022 on the 3' end makes it a functional transposon. pSB1A2-Bca1013 false false _95_ 0 483 95 It's complicated false N/A false John Anderson BBa_R0085 1 BBa_R0085 T7 Consensus Promoter Sequence 2005-02-21T12:00:00Z 2015-05-08T01:14:15Z Sequence obtained from Sri Kosuri Released HQ 2013 The T7 promoter should only produce PoPS when the T7 polymerase is also being expressed. false false _11_6_ 0 135 7 In stock false false Barry Canton annotation1721522 1 Initiation Region range1721522 1 12 23 annotation1721521 1 Polymerase Binding Region range1721521 1 1 11 annotation1721520 1 Transcription Start Site range1721520 1 18 18 BBa_J61028_sequence 1 taatacgactcactatagggagatactagagagatgtgtataagagacag BBa_R0085_sequence 1 taatacgactcactatagggaga BBa_J61022_sequence 1 agatgtgtataagagacag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z