BBa_J62002 1 BBa_J62002 {SH3 ligand} 2008-07-25T11:00:00Z 2015-08-31T01:56:25Z single forward and reverse primer designed to anneal with sites that can be ligated to BglII and XhoI digested vector. Sequence encoding an N-terminal 5 total amino acid glycine/serine linker and a peptide ligand with a Kd=0.1uM affinity for murine Crk N-terminal SH3 domain. Degenerate sequence "A." false false _96_ 0 929 96 Not in stock false N/A false John Dueber BBa_J62002_sequence 1 ggcagcggttcggggagcggcccaccgcctgcgctgccgccaaaacgccgtcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z