BBa_J62007 1 BBa_J62007 {SH3 ligand}{SH3 ligand} 2008-07-28T11:00:00Z 2015-08-31T01:56:26Z BBa_J62004 is the 5' part and BBa_J62002 is the 3' part assembled using BBb format to make a GGATCT scar. two repeats of a 5' glycine-serine linker followed by an SH3 ligand with a Kd=0.1uM affinity for N-terminal murine SH3 domain. The sequence for these two repeats are degenerate ("C" and "A"). false false _96_ 0 929 96 Not in stock false N/A false John Dueber annotation1969233 1 BBa_J62004 range1969233 1 1 54 annotation1969234 1 BBa_J62002 range1969234 1 61 114 BBa_J62007_sequence 1 gggagtggcagcggctcgggtccgccaccggcattgcccccgaaacgtcggcgcggatctggcagcggttcggggagcggcccaccgcctgcgctgccgccaaaacgccgtcgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z