BBa_J63008 1 SV40 NLS SV40 nuclear localization sequence from SV40; yeast codon optimized 2006-10-10T11:00:00Z 2015-08-31T01:56:26Z direct synthesis from published sequence Released HQ 2013 yeast codon-optimized nuclear localization sequence from simian virus 40 false true _97_ 0 545 97 In stock false as described in literature true Caroline Ajo-Franklin BBa_J63008_sequence 1 cccaagaaaaagcgcaaggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z