BBa_J64000 1 BBa_J64000 rhlI promoter 2007-01-15T12:00:00Z 2015-08-31T01:56:26Z Genomic sequence of Pseudomonas aeruginosa Promoter driving the rhlI gene in Pseudomonas aeruginosa. Activated by the RhlR+C4HSL. Also likely activated by LasR+3OC12HSL false false _98_ 0 88 98 Not in stock false none false Jeffrey J Tabor annotation1910614 1 Rhl box range1910614 1 11 30 BBa_J64000_sequence 1 ggtcggcgcgccctaccagatctggcaggttgcctgccgttcatcctcctttagtcttccccctcatgtgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z