BBa_J64001 1 BBa_J64001 psicA from <I>Salmonella</I> 2008-01-14T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The sicA promoter is a regulatory element in the Salmonella SPI-1 secretion system. It controls the expression of secreted effector proteins in the natural system and turns on late. Please reference Temme et al, 2008, JMB for exact dynamics of this promoter and associated feedback mechanisms. This promoter only functions in Salmonella strains containing SPI-1. false false _98_ 0 2407 98 Not in stock false This part can only be used in salmonella strains. false Dan Widmaier annotation1959631 1 +1 Transcriptional Start Site range1959631 1 106 106 annotation1959630 1 -10 Hexamer range1959630 1 94 100 annotation1959627 1 sicA Promoter range1959627 1 1 143 annotation1959629 1 -35 Hexamer range1959629 1 71 77 annotation1959628 1 InvF:SicA Binding Box range1959628 1 54 65 BBa_J64001_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z