BBa_J64007 1 BBa_J64007 TEVr 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetically created from oligonucleotide synthesis The Tobacco Etch Virus (TEV) protease cleavage recognition sequence. This DNA sequence encodes an amino acid sequence recognized by TEV protease (ENLYFQS) for efficient cleavage. The sequence is flanked by glycines on the ends to increase flexibility and accessibility to the protease. After proteolytic processing the C-terminal fragment retains only an S residue, however by the design of this part it will leave an SG dipeptide which becomes the new N-terminus of the mature polypeptide. false false _98_ 0 2407 98 Not in stock false This part was codon optimized for expression in E.Coli. false Dan Widmaier annotation1959597 1 TEV protease recognition sequence range1959597 1 4 24 annotation1959598 1 Gly range1959598 1 1 3 annotation1959599 1 Gly range1959599 1 25 27 BBa_J64007_sequence 1 ggagagaatttgtattttcagtcagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z