BBa_J64009 1 BBa_J64009 InvB Secretion Chaperone 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The InvB protein is a promiscuous chaperone in the Type III Secretion system (T3S) that assists in the secretion of SipA, SopA, and SopE2 effector proteins. This chaperone binds to the secretion signal of selected proteins and maintains the N-terminus in an unfolded state for secretion by the T3S. The chaperone is critical in coordinating the timing and localization to the proper secretion mechanism and is vital in secreting heterologous proteins with this system. false false _98_ 0 2407 98 Not in stock false This part was not designed to be compatible with biobricks standard assembly false Dan Widmaier annotation1959603 1 invB range1959603 1 1 408 BBa_J64009_sequence 1 atgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z