BBa_J64010 1 BBa_J64010 lasI promoter 2007-01-15T12:00:00Z 2015-08-31T01:56:26Z Genomic sequence of Pseudomonas aeruginosa Promoter driving the lasI gene in Pseudomonas aeruginosa. <br> Activated by LasR+3OC12HSL and not RhlR+C4HSL (Seed et al., 1995) <br> ~4x stronger than the lasB promoter (BBa_R0079; Seed et al., 1995). <br> Switch point ~0.1nM 3OC12HSL (Seed et al., 1995) false false _98_ 0 88 98 Not in stock false Promoter sequence cropped to 4nt upstream of Las box according to example of Whiteley and Greenberg, J. Bac, 2001 false Jeffrey J Tabor annotation1910616 1 +1 range1910616 1 53 53 annotation1910615 1 Las box range1910615 1 5 20 BBa_J64010_sequence 1 aaatctatctcatttgctagttataaaattatgaaatttgcataaattcttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z