BBa_J64012 1 BBa_J64012 SipA Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the N-terminal 169 amino acids of the SipA effector protein from the Salmonella Type III Secretion System (T3S). These residues comprise the required elements for directing secretion to the T3S. This secretion signal requires the chaperone invB (BBa_J64009) to properly localize to the export apparatus and be secreted in high titer. false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. false Dan Widmaier annotation1959611 1 sipA range1959611 1 1 507 BBa_J64012_sequence 1 atggttacaagtgtaaggactcagccccccgtcataatgccaggtatgcagaccgagatcaaaacgcaggccacgaatcttgcggcgaatctttccgcagtcagagaaagtgccacagcgacgctgtcaggggaaattaaaggcccgcaactggaagattttcccgcgctgatcaaacaggcgagtctggatgcattgtttaaatgcgggaaagacgctgaggcgttaaaagaagtttttaccaattcaaataatgtcgccggtaagaaagcgataatggagtttgccgggctctttcgttcagcgctcaacgccaccagtgattctcctgaggcgaagacgctactgatgaaggtgggggcagagtataccgcgcaaatcataaaagatggcctgaaagaaaagtcagcttttgggccatggctgccagaaacaaagaaagcggaagcgaagctggaaaacctggaaaagcagctgttagatattatcaaaaataacactggcggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z