BBa_J64016 1 BBa_J64016 sopE2 Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 105 amino acid secretion signal for the sopE2 effector protein in Salmonella Type III Secretion. The sequence includes components necessary for directing a fused protein to the export apparatus and secretion to the extracellular space. The cognate chaperone for this sequence is invB (BBa_J64009) and is required to be co-expressed for high titer secretion of protein. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959615 1 sopE2 Secretion Signal range1959615 1 1 315 BBa_J64016_sequence 1 atgactaacataacactatccacccagcactacagaatccatagaagtgacgttgaaccagtaaaagaaaaaacaacggagaaggacatttttgcaaaaagtattactgccgttagaaatagctttatcagcctgtcgacgagtctgtcagatcgttttagcctgcatcaacaaacagacataccgactacccattttcatcgtgggaacgcttctgagggtagggcggtattaaccagtaaaactgttaaagattttatgctgcaaaagctcaatagtctggatatcaaaggtaatgcgagtaaagatccggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z