BBa_J64017 1 BBa_J64017 invJ Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 15 amino acid secretion signal for the InvJ protein in the Salmonella Type III Secretion System. This signal when fused to a protein of interest will direct the chimeric protein to the secretion apparatus and into the extracellular environment. It should be noted that while this tag is very short it does not require a cognate chaperone. However, although no complex has been observed in the literature secretion cannot occur without the co-expression of the invI protein (BBa_J64019). false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. false Dan Widmaier annotation1959616 1 InvJ secretion signal range1959616 1 1 45 BBa_J64017_sequence 1 atgggcgatgtgtcagctgtcagttcatccgggaacattttactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z