BBa_J64019 1 BBa_J64019 invI SPI-1 Protein 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA This part is the invI protein from the Salmonella Type III Secretion System. This part is a required co-expressed protein with the invJ secretion tag (BBa_J6017) to allow for expression and secretion. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959618 1 invI range1959618 1 1 426 BBa_J64019_sequence 1 atgcattcgctgaccagaattaaagtattgcagcggcgctgtacggtatttcattcacagtgtgagtcgatattacttcgctatcaggatgaggaccgcgggctgcaggccgaggaggaggcgatccttgaacaaatagcgggtctgaaattgttattagatacgctgcgtgcagaaaacagacagctcagtcgtgaggaaatttatacgttattacgtaagcagtctattgttcgccggcagataaaagatttagaactccagattatacaaattcaggaaaaacggagcgagctggaaaagaaaagggaagagtttcagaaaaaaagtaaatattggttgcgcaaagaagggaactatcaacgctggataatccgtcagaaaagattctatatccagcgagagatacagcaggaagaggccgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z