BBa_J64020 1 BBa_J64020 invI RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA This part is the natural invI RBS from Salmonella Typhimurium LT2. false false _98_ 0 2407 98 Not in stock false This part was not designed with consideration for biobrick standard assembly in mind. This RBS has not been explicitly tested for expression level in a fluorescence or B-Gal assay. false Dan Widmaier annotation1959619 1 invI RBS range1959619 1 1 20 BBa_J64020_sequence 1 tgacacgttgagcggtatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z