BBa_J64021 1 BBa_J64021 sicA Chaperone 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA. This part is a secretion chaperone from the Salmonella Type III Secretion System (T3S). SicA is required for secretion of sipC protein or sipC tagged heterologous proteins. SicA also functions as a component of a positive feedback loop involving the sicA promoter and invF. For more information see Temme et al in the reference section. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly in mind. false Dan Widmaier annotation1959620 1 sicA range1959620 1 1 498 BBa_J64021_sequence 1 atggattatcaaaataatgtcagcgaagaacgtgttgcggaaatgatttgggatgccgttagtgaaggcgccacgctaaaagacgttcatgggatccctcaagatatgatggacggtttatatgctcatgcttatgagttttataaccagggacgactggatgaagctgagacgttctttcgtttcttatgcatttatgatttttacaatcccgattacaccatgggactggcggcagtatgccaactgaaaaaacaatttcagaaagcatgtgacctttatgcagtagcgtttacgttacttaaaaatgattatcgccccgttttttttaccgggcagtgtcaattattaatgcgtaaggcagcaaaagccagacagtgttttgaacttgtcaatgaacgtactgaagatgagtctctgcgggcaaaagcgttggtctatctggaggcgctaaaaacggcggagacagagcagcacagtgaacaagaaaaggaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z