BBa_J64023 1 BBa_J64023 sipC Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 167 amino acid secretion signal for the sipC protein in the Salmonella Type III Secretion System. This secretion signal can be fused to proteins of interest and will direct secretion to the extracellular space via the type III secretion apparatus. For secretion at high titer co-expression of the sicA chaperone protein (BBa_J64021) is required. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobricks standard assembly in mind. false Dan Widmaier annotation1959622 1 sipC Secretion Signal range1959622 1 1 363 BBa_J64023_sequence 1 atgttaattagtaatgtgggaataaatcccgccgcttatttaaataatcattctgttgagaatagttcacagacagcttcgcaatccgttagcgctaaagatattctgaatagtattggtattagcagcagtaaagtcagtgacctggggttgagtcctacactgagcgcgcctgcgccaggggtattaacgcaaacccccggaacgatcacgtcctttttaaaagccagtattcaaaataccgacatgaatcaggatttgaatgctctggcaaataatgtcacgactaaagcgaatgaggttgtgcaaacccagttacgcgagcagcaggcagaagtcggaaagttttttgatattagcgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z