BBa_J64027 1 BBa_J64027 sopB Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part consists of the 168 amino acid secretion signal of sopB in the Salmonella Type III Secretion System (T3S). When fused to a protein of interest this signal, when co-expressed with the cognate chaperone sigE (BBa_J64025), will be directed to the T3S secretion apparatus for export to the extracellular environment. The co-expression of the chaperone is critical for high titers of secreted protein. false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. false Dan Widmaier annotation1959626 1 sopB secretion signal range1959626 1 1 504 BBa_J64027_sequence 1 atgcaaatacagagcttctatcactcagcttcactaaaaacccaggaggcttttaaaagcctacaaaaaaccttatacaacggaatgcagattctctcaggccagggcaaagcgccggctaaagcgcccgacgctcgcccggaaattattgtcctgcgagaacccggcgcgacatgggggaattatctacagcatcagaaggcgtctaaccactcgctgcataacctctataacttacagcgcgatcttcttaccgtcgcggcaaccgttctgggtaaacaagacccggttctaacgtcaatggcaaaccaaatggagttagccaaagttaaagcggaccggccagcaacaaaacaagaagaagccgcggcaaaagcattgaagaaaaatcttatcgaacttattgcagcacgcactcagcagcaggatggcttacctgcaaaagaagctcatcgctttgcggcagtagcgtttagagatgctcaggtcaagcagcttaataac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z