BBa_J64028 1 BBa_J64028 sopB RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the natural RBS for the sopB gene in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with consideration for biobrick standard assembly in mind. This RBS hasn't been explicitly tested for expression rate in a Fluorescence or B-Gal assay. false Dan Widmaier annotation1959632 1 sopB RBS range1959632 1 1 20 BBa_J64028_sequence 1 tcaggaatattaaaaacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z