BBa_J64031 1 BBa_J64031 sptP RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS for the sptP gene in Salmonella Type III Secretion false false _98_ 0 2407 98 Not in stock false This part was designed without consideration for biobrick standard assembly. This RBS has not been explicitly tested for expression rate. false Dan Widmaier annotation1959635 1 sptP RBS range1959635 1 1 20 BBa_J64031_sequence 1 caaaaacatactgcaggaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z