BBa_J64022 1 BBa_J64022 sicA RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS from the sicA chaperone (BBa_J6021) in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with standard biobrick assembly in mind. false Dan Widmaier annotation1959621 1 misc range1959621 1 1 20 BBa_J64033 1 BBa_J64033 pCASP - Chaperone 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z This is a composite part with both synthetic and genomic source DNA This is a variant of the pCASP secretion circuit lacking the chaperone (sicP) for the SptP167 secretion tag. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly in mind and might contain scar sequence cutsites throughout. false Dan Widmaier component2225017 1 BBa_J64007 component2225009 1 BBa_J64001 component2225011 1 BBa_J64022 component2225027 1 BBa_J64043 component2225025 1 BBa_J64005 component2225021 1 BBa_J64004 component2225013 1 BBa_J64003 annotation2225011 1 BBa_J64022 range2225011 1 144 163 annotation2225013 1 BBa_J64003 range2225013 1 164 664 annotation2225021 1 BBa_J64004 range2225021 1 692 1312 annotation2225027 1 BBa_J64043 range2225027 1 1394 1498 annotation2225009 1 BBa_J64001 range2225009 1 1 143 annotation2225025 1 BBa_J64005 range2225025 1 1313 1393 annotation2225017 1 BBa_J64007 range2225017 1 665 691 BBa_J64043 1 BBa_J64043 T1 terminator 2008-01-21T12:00:00Z 2015-05-08T01:08:16Z Commercial plasmid DNA This is the T1 terminator from the pPROTet 6xHN vector commercially available from Clontech. false false _98_ 0 2407 98 Not in stock false This sequence is not designed with biobrick standard assembly compatibility in mind. false Dan Widmaier annotation1960020 1 T1 Terminator range1960020 1 1 105 BBa_J64007 1 BBa_J64007 TEVr 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetically created from oligonucleotide synthesis The Tobacco Etch Virus (TEV) protease cleavage recognition sequence. This DNA sequence encodes an amino acid sequence recognized by TEV protease (ENLYFQS) for efficient cleavage. The sequence is flanked by glycines on the ends to increase flexibility and accessibility to the protease. After proteolytic processing the C-terminal fragment retains only an S residue, however by the design of this part it will leave an SG dipeptide which becomes the new N-terminus of the mature polypeptide. false false _98_ 0 2407 98 Not in stock false This part was codon optimized for expression in E.Coli. false Dan Widmaier annotation1959598 1 Gly range1959598 1 1 3 annotation1959599 1 Gly range1959599 1 25 27 annotation1959597 1 TEV protease recognition sequence range1959597 1 4 24 BBa_J64003 1 BBa_J64003 sptP167 2008-01-14T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This coding region is the first 167 N-terminal residues from the SptP effector protein in the Salmonella SPI-1 pathogenesis system. This tag is sufficient when used with sicP (BBa_J64002) to direct a fused heterologous protein for secretion through the SPI-1 system. In the natural system this coding frame overlaps with the 3' end of the sicP coding frame. false false _98_ 0 2407 98 Not in stock false This coding sequence was not designed to conform with biobrick standard assembly. false Dan Widmaier annotation1959593 1 SptP167 range1959593 1 1 501 BBa_J64004 1 BBa_J64004 DH domain constitutively active 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Human Genomic DNA library clone with 2 point mutations This protein coding frame is a Guanine Exchange Factor (GEF) domain from human eukaryotic with point mutations to make it constitutively active. This protein can be secreted at high titer via the Salmonella T3S using the Voigt Lab secretion circuit. false false _98_ 0 2407 98 Not in stock false This part contains 2 PstI sites and is incompatible with biobrick standard assembly false Dan Widmaier annotation1960212 1 HindIII Restriction Site range1960212 1 1 6 annotation1959594 1 DH Domain range1959594 1 7 612 annotation1960213 1 NotI Restriction Site range1960213 1 613 621 BBa_J64005 1 3x FLAG 3x FLAG affinity tag 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetic DNA from Oligonucleotide synthesis A 3 repeat FLAG (DYKDDDDK) antigen epitope tag used for marking proteins of interest. Proteins carrying this tag can be easily detected using commercial western blotting reagents. false false _98_ 0 2407 98 Not in stock false This sequence was designed as part of an oligonucleotide primer on each strand then annealed and ligated into the vector. false Dan Widmaier annotation1959596 1 STOP Codon range1959596 1 73 75 annotation1960214 1 XbaI Restriction Site range1960214 1 76 81 annotation1959595 1 3x FLAG Tag range1959595 1 1 72 BBa_J64001 1 BBa_J64001 psicA from <I>Salmonella</I> 2008-01-14T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The sicA promoter is a regulatory element in the Salmonella SPI-1 secretion system. It controls the expression of secreted effector proteins in the natural system and turns on late. Please reference Temme et al, 2008, JMB for exact dynamics of this promoter and associated feedback mechanisms. This promoter only functions in Salmonella strains containing SPI-1. false false _98_ 0 2407 98 Not in stock false This part can only be used in salmonella strains. false Dan Widmaier annotation1959627 1 sicA Promoter range1959627 1 1 143 annotation1959629 1 -35 Hexamer range1959629 1 71 77 annotation1959628 1 InvF:SicA Binding Box range1959628 1 54 65 annotation1959631 1 +1 Transcriptional Start Site range1959631 1 106 106 annotation1959630 1 -10 Hexamer range1959630 1 94 100 BBa_J64001_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggt BBa_J64004_sequence 1 aagcttgatatgttgaccccaactgaaagaaagcgacaaggatacatccacgagctcattgtcaccgaggagaactatgtgaatgacctgcagctggtcacagagatttttcaaaaacccctgatggagtctgagctgctgacagaaaaagaggttgctatgatttttgtgaactggaaggagctgattatgtgtaatatcaaactactaaaagcgctgagagtccgcaagaagatgtccggggagaagatgcctgtgaagatgattggagacatcctgagcgcacagctgccgcacatgcagccctacatccgcttctgcagccgccagctcaacggggctgccctgatccagcagaagacggacgaggccccagacttcaaggagttcgtcaaaagattggcaatggatcctcggtgtaaagggatgccactctctagttttatactgaagcctatgcaacgggtaacaagatacccactgatcattaaaaatatcctggaaaacacccctgaaaaccacccggaccacagccacttgaagcacgccctggagaaggcggaagagctctgttcccaggtgaacgaaggggtgcgggagaaggagaactctagcggccgc BBa_J64043_sequence 1 ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga BBa_J64003_sequence 1 atgctaaagtatgaggagagaaaattgaataatttaacgttgtcttcgttttcaaaagttggtgtgtcgaatgatgcccgactttatattgctaaggaaaatactgataaggcatatgttgcgcctgaaaaattttcgtcaaaagtattaacctggcttggaaaaatgccgttatttaaaaacactgaagtggtgcaaaaacatacggaaaatatcagagtacaggaccaaaagattttacagacatttctccatgcactaacggaaaaatatggggaaacagcggttaatgacgcactgttaatgtcccgtataaatatgaacaaaccccttacccaacgtttagcagtgcagatcacggagtgtgtaaaagctgctgacgaagggtttataaaccttattaagagcaaggataatgttggtgtcaggaatgccgctttagtcataaaaggcggcgatacaaaagtggcagaaaaaaataacgatgttggagcagaaagt BBa_J64033_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggtacagataacaggagtaagtaatgctaaagtatgaggagagaaaattgaataatttaacgttgtcttcgttttcaaaagttggtgtgtcgaatgatgcccgactttatattgctaaggaaaatactgataaggcatatgttgcgcctgaaaaattttcgtcaaaagtattaacctggcttggaaaaatgccgttatttaaaaacactgaagtggtgcaaaaacatacggaaaatatcagagtacaggaccaaaagattttacagacatttctccatgcactaacggaaaaatatggggaaacagcggttaatgacgcactgttaatgtcccgtataaatatgaacaaaccccttacccaacgtttagcagtgcagatcacggagtgtgtaaaagctgctgacgaagggtttataaaccttattaagagcaaggataatgttggtgtcaggaatgccgctttagtcataaaaggcggcgatacaaaagtggcagaaaaaaataacgatgttggagcagaaagtggagagaatttgtattttcagtcaggaaagcttgatatgttgaccccaactgaaagaaagcgacaaggatacatccacgagctcattgtcaccgaggagaactatgtgaatgacctgcagctggtcacagagatttttcaaaaacccctgatggagtctgagctgctgacagaaaaagaggttgctatgatttttgtgaactggaaggagctgattatgtgtaatatcaaactactaaaagcgctgagagtccgcaagaagatgtccggggagaagatgcctgtgaagatgattggagacatcctgagcgcacagctgccgcacatgcagccctacatccgcttctgcagccgccagctcaacggggctgccctgatccagcagaagacggacgaggccccagacttcaaggagttcgtcaaaagattggcaatggatcctcggtgtaaagggatgccactctctagttttatactgaagcctatgcaacgggtaacaagatacccactgatcattaaaaatatcctggaaaacacccctgaaaaccacccggaccacagccacttgaagcacgccctggagaaggcggaagagctctgttcccaggtgaacgaaggggtgcgggagaaggagaactctagcggccgcgattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctagaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga BBa_J64005_sequence 1 gattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctaga BBa_J64022_sequence 1 acagataacaggagtaagta BBa_J64007_sequence 1 ggagagaatttgtattttcagtcagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z