BBa_J64022 1 BBa_J64022 sicA RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS from the sicA chaperone (BBa_J6021) in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with standard biobrick assembly in mind. false Dan Widmaier annotation1959621 1 misc range1959621 1 1 20 BBa_J64005 1 3x FLAG 3x FLAG affinity tag 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Synthetic DNA from Oligonucleotide synthesis A 3 repeat FLAG (DYKDDDDK) antigen epitope tag used for marking proteins of interest. Proteins carrying this tag can be easily detected using commercial western blotting reagents. false false _98_ 0 2407 98 Not in stock false This sequence was designed as part of an oligonucleotide primer on each strand then annealed and ligated into the vector. false Dan Widmaier annotation1960214 1 XbaI Restriction Site range1960214 1 76 81 annotation1959596 1 STOP Codon range1959596 1 73 75 annotation1959595 1 3x FLAG Tag range1959595 1 1 72 BBa_J64034 1 BBa_J64034 pCASP (-)Chaperone (-)SptP167 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z This is composed of DNA from multiple sources This is a variant of pCASP lacking both the sptP167 secretion tag and the sicP chaperone. false false _98_ 0 2407 98 Not in stock false This device was not designed with biobrick standard assembly in mind and might contain scar sequence endonuclease digest sites. false Dan Widmaier component2222119 1 BBa_J64036 component2222123 1 BBa_J64005 component2222125 1 BBa_J64043 component2222115 1 BBa_J64001 component2222117 1 BBa_J64022 annotation2222117 1 BBa_J64022 range2222117 1 144 163 annotation2222123 1 BBa_J64005 range2222123 1 773 853 annotation2222119 1 BBa_J64036 range2222119 1 164 772 annotation2222115 1 BBa_J64001 range2222115 1 1 143 annotation2222125 1 BBa_J64043 range2222125 1 854 958 BBa_J64001 1 BBa_J64001 psicA from <I>Salmonella</I> 2008-01-14T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The sicA promoter is a regulatory element in the Salmonella SPI-1 secretion system. It controls the expression of secreted effector proteins in the natural system and turns on late. Please reference Temme et al, 2008, JMB for exact dynamics of this promoter and associated feedback mechanisms. This promoter only functions in Salmonella strains containing SPI-1. false false _98_ 0 2407 98 Not in stock false This part can only be used in salmonella strains. false Dan Widmaier annotation1959628 1 InvF:SicA Binding Box range1959628 1 54 65 annotation1959627 1 sicA Promoter range1959627 1 1 143 annotation1959631 1 +1 Transcriptional Start Site range1959631 1 106 106 annotation1959629 1 -35 Hexamer range1959629 1 71 77 annotation1959630 1 -10 Hexamer range1959630 1 94 100 BBa_J64043 1 BBa_J64043 T1 terminator 2008-01-21T12:00:00Z 2015-05-08T01:08:16Z Commercial plasmid DNA This is the T1 terminator from the pPROTet 6xHN vector commercially available from Clontech. false false _98_ 0 2407 98 Not in stock false This sequence is not designed with biobrick standard assembly compatibility in mind. false Dan Widmaier annotation1960020 1 T1 Terminator range1960020 1 1 105 BBa_J64036 1 BBa_J64036 DH domain constitutively active +atg 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z Plasmid DNA This is a DH domain (same as BBa_J64004) but has a start (atg) codon on the 5' end. false false _98_ 0 2407 98 Not in stock false This is not compatible with biobrick standard assembly false Dan Widmaier annotation1959719 1 DH domain range1959719 1 1 609 BBa_J64001_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggt BBa_J64036_sequence 1 atggatatgttgaccccaactgaaagaaagcgacaaggatacatccacgagctcattgtcaccgaggagaactatgtgaatgacctgcagctggtcacagagatttttcaaaaacccctgatggagtctgagctgctgacagaaaaagaggttgctatgatttttgtgaactggaaggagctgattatgtgtaatatcaaactactaaaagcgctgagagtccgcaagaagatgtccggggagaagatgcctgtgaagatgattggagacatcctgagcgcacagctgccgcacatgcagccctacatccgcttctgcagccgccagctcaacggggctgccctgatccagcagaagacggacgaggccccagacttcaaggagttcgtcaaaagattggcaatggatcctcggtgtaaagggatgccactctctagttttatactgaagcctatgcaacgggtaacaagatacccactgatcattaaaaatatcctggaaaacacccctgaaaaccacccggaccacagccacttgaagcacgccctggagaaggcggaagagctctgttcccaggtgaacgaaggggtgcgggagaaggagaactct BBa_J64043_sequence 1 ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga BBa_J64034_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggtacagataacaggagtaagtaatggatatgttgaccccaactgaaagaaagcgacaaggatacatccacgagctcattgtcaccgaggagaactatgtgaatgacctgcagctggtcacagagatttttcaaaaacccctgatggagtctgagctgctgacagaaaaagaggttgctatgatttttgtgaactggaaggagctgattatgtgtaatatcaaactactaaaagcgctgagagtccgcaagaagatgtccggggagaagatgcctgtgaagatgattggagacatcctgagcgcacagctgccgcacatgcagccctacatccgcttctgcagccgccagctcaacggggctgccctgatccagcagaagacggacgaggccccagacttcaaggagttcgtcaaaagattggcaatggatcctcggtgtaaagggatgccactctctagttttatactgaagcctatgcaacgggtaacaagatacccactgatcattaaaaatatcctggaaaacacccctgaaaaccacccggaccacagccacttgaagcacgccctggagaaggcggaagagctctgttcccaggtgaacgaaggggtgcgggagaaggagaactctgattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctagaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga BBa_J64005_sequence 1 gattataaagatgacgatgacaaggattataaagatgacgatgacaaggattataaagatgacgatgacaagtaatctaga BBa_J64022_sequence 1 acagataacaggagtaagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z