BBa_J64035 1 BBa_J64035 invB Chaperone sipA Tag 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z These parts come from both genomic and synthetic sources This is a variant of the pCASP plasmid with the invB chaperone and sipA secretion signal. false false _98_ 0 2407 98 Not in stock false This device was designed without biobrick standard assembly in mind so scar sequence restriction sites might exist within the device. false Dan Widmaier component1960341 1 BBa_J64009 component1960339 1 BBa_J64011 component1960345 1 BBa_J64012 component1960343 1 BBa_J64013 annotation1960339 1 BBa_J64011 range1960339 1 1 19 annotation1960343 1 BBa_J64013 range1960343 1 428 445 annotation1960341 1 BBa_J64009 range1960341 1 20 427 annotation1960345 1 BBa_J64012 range1960345 1 446 952 BBa_J64013 1 BBa_J64013 sipA RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS that drives the sipA effector protein in the Salmonella SPI-1 system false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. This RBS has not been explicitly tested in an expression assasy such as B-Gal or GFP expression. false Dan Widmaier annotation1959612 1 sicA RBS range1959612 1 1 18 BBa_J64011 1 BBa_J64011 invB RBS 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The natural RBS that drives invB false false _98_ 0 2407 98 Not in stock false The expression level of this RBS has not been quantified. false Dan Widmaier annotation1959604 1 invB RBS range1959604 1 1 19 BBa_J64009 1 BBa_J64009 InvB Secretion Chaperone 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The InvB protein is a promiscuous chaperone in the Type III Secretion system (T3S) that assists in the secretion of SipA, SopA, and SopE2 effector proteins. This chaperone binds to the secretion signal of selected proteins and maintains the N-terminus in an unfolded state for secretion by the T3S. The chaperone is critical in coordinating the timing and localization to the proper secretion mechanism and is vital in secreting heterologous proteins with this system. false false _98_ 0 2407 98 Not in stock false This part was not designed to be compatible with biobricks standard assembly false Dan Widmaier annotation1959603 1 invB range1959603 1 1 408 BBa_J64012 1 BBa_J64012 SipA Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the N-terminal 169 amino acids of the SipA effector protein from the Salmonella Type III Secretion System (T3S). These residues comprise the required elements for directing secretion to the T3S. This secretion signal requires the chaperone invB (BBa_J64009) to properly localize to the export apparatus and be secreted in high titer. false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. false Dan Widmaier annotation1959611 1 sipA range1959611 1 1 507 BBa_J64009_sequence 1 atgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataa BBa_J64013_sequence 1 cagaagaggatattaata BBa_J64012_sequence 1 atggttacaagtgtaaggactcagccccccgtcataatgccaggtatgcagaccgagatcaaaacgcaggccacgaatcttgcggcgaatctttccgcagtcagagaaagtgccacagcgacgctgtcaggggaaattaaaggcccgcaactggaagattttcccgcgctgatcaaacaggcgagtctggatgcattgtttaaatgcgggaaagacgctgaggcgttaaaagaagtttttaccaattcaaataatgtcgccggtaagaaagcgataatggagtttgccgggctctttcgttcagcgctcaacgccaccagtgattctcctgaggcgaagacgctactgatgaaggtgggggcagagtataccgcgcaaatcataaaagatggcctgaaagaaaagtcagcttttgggccatggctgccagaaacaaagaaagcggaagcgaagctggaaaacctggaaaagcagctgttagatattatcaaaaataacactggcggt BBa_J64035_sequence 1 ttaattaaggaaaagatctatgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataacagaagaggatattaataatggttacaagtgtaaggactcagccccccgtcataatgccaggtatgcagaccgagatcaaaacgcaggccacgaatcttgcggcgaatctttccgcagtcagagaaagtgccacagcgacgctgtcaggggaaattaaaggcccgcaactggaagattttcccgcgctgatcaaacaggcgagtctggatgcattgtttaaatgcgggaaagacgctgaggcgttaaaagaagtttttaccaattcaaataatgtcgccggtaagaaagcgataatggagtttgccgggctctttcgttcagcgctcaacgccaccagtgattctcctgaggcgaagacgctactgatgaaggtgggggcagagtataccgcgcaaatcataaaagatggcctgaaagaaaagtcagcttttgggccatggctgccagaaacaaagaaagcggaagcgaagctggaaaacctggaaaagcagctgttagatattatcaaaaataacactggcggt BBa_J64011_sequence 1 ttaattaaggaaaagatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z