BBa_J64014 1 BBa_J64014 sopA Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part encodes the secretion signal for the sopA protein in the Salmonella Type III Secretion System (T3S). This signal is sufficient to direct a fused protein to secrete through T3S and includes the necessary chaperone binding domain. The cognate chaperone for sopA is invB (BBa_J64009) and is required for secretion at high titer. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959613 1 sopA Secretion Signal range1959613 1 1 288 BBa_J64037 1 BBa_J64037 invB Chaperone sopA Tag 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z This device is composed of parts form Salmonella LT2 genomic DNA This is a variant of the pCASP secretion circuit with the invB chaperone and the sopA secretion signal. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly compatibility in mind, it might contain scar sequence cutsites. false Dan Widmaier component1960337 1 BBa_J64014 component1960333 1 BBa_J64009 component1960331 1 BBa_J64011 component1960335 1 BBa_J64015 annotation1960335 1 BBa_J64015 range1960335 1 428 443 annotation1960333 1 BBa_J64009 range1960333 1 20 427 annotation1960337 1 BBa_J64014 range1960337 1 444 731 annotation1960331 1 BBa_J64011 range1960331 1 1 19 BBa_J64011 1 BBa_J64011 invB RBS 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The natural RBS that drives invB false false _98_ 0 2407 98 Not in stock false The expression level of this RBS has not been quantified. false Dan Widmaier annotation1959604 1 invB RBS range1959604 1 1 19 BBa_J64009 1 BBa_J64009 InvB Secretion Chaperone 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The InvB protein is a promiscuous chaperone in the Type III Secretion system (T3S) that assists in the secretion of SipA, SopA, and SopE2 effector proteins. This chaperone binds to the secretion signal of selected proteins and maintains the N-terminus in an unfolded state for secretion by the T3S. The chaperone is critical in coordinating the timing and localization to the proper secretion mechanism and is vital in secreting heterologous proteins with this system. false false _98_ 0 2407 98 Not in stock false This part was not designed to be compatible with biobricks standard assembly false Dan Widmaier annotation1959603 1 invB range1959603 1 1 408 BBa_J64015 1 BBa_J64015 sopA RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS associated with the sopA effector protein in the Salmonella SPI-1 system. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. This RBS hasn't been explicitly tested in an expression assay such as GFP fluorescence or B-Gal expression. false Dan Widmaier annotation1959614 1 sopA RBS range1959614 1 1 16 BBa_J64009_sequence 1 atgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataa BBa_J64037_sequence 1 ttaattaaggaaaagatctatgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataattgataaggaattgtaatgaagatatcatcaggcgcaattaatttttctactattcctaaccaggttaaaaaattaattacctctattcgtgaacatacgaaaaacgggctcacctcaaaaataaccagtgttaaaaacacgcatacatctttaaatgaaaaatttaaaacaggaaaggactcaccgattgagttcgcgttaccacaaaaaataaaagacttctttcagccgaaagataaaaacaccttaaacaaaacattgattactgttaaaaatattaaagatacaaataatgcaggcaag BBa_J64015_sequence 1 ttgataaggaattgta BBa_J64014_sequence 1 atgaagatatcatcaggcgcaattaatttttctactattcctaaccaggttaaaaaattaattacctctattcgtgaacatacgaaaaacgggctcacctcaaaaataaccagtgttaaaaacacgcatacatctttaaatgaaaaatttaaaacaggaaaggactcaccgattgagttcgcgttaccacaaaaaataaaagacttctttcagccgaaagataaaaacaccttaaacaaaacattgattactgttaaaaatattaaagatacaaataatgcaggcaag BBa_J64011_sequence 1 ttaattaaggaaaagatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z