BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_J64016 1 BBa_J64016 sopE2 Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 105 amino acid secretion signal for the sopE2 effector protein in Salmonella Type III Secretion. The sequence includes components necessary for directing a fused protein to the export apparatus and secretion to the extracellular space. The cognate chaperone for this sequence is invB (BBa_J64009) and is required to be co-expressed for high titer secretion of protein. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959615 1 sopE2 Secretion Signal range1959615 1 1 315 BBa_J64011 1 BBa_J64011 invB RBS 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The natural RBS that drives invB false false _98_ 0 2407 98 Not in stock false The expression level of this RBS has not been quantified. false Dan Widmaier annotation1959604 1 invB RBS range1959604 1 1 19 BBa_J64038 1 BBa_J64038 invB Chaperone sopE2 Tag 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z The source parts for this device come from Salmonella LT2 Genomic DNA This is a variant of the pCASP secretion circuit with the invB chaperone and sopE2 secretion signal false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly compatibility in mind, it might contain scar sequence cutsites. false Dan Widmaier component1960349 1 BBa_J64009 component1960347 1 BBa_J64011 component1960354 1 BBa_J64016 component1960351 1 BBa_B0030 annotation1960351 1 BBa_B0030 range1960351 1 428 442 annotation1960354 1 BBa_J64016 range1960354 1 443 757 annotation1960347 1 BBa_J64011 range1960347 1 1 19 annotation1960349 1 BBa_J64009 range1960349 1 20 427 BBa_J64009 1 BBa_J64009 InvB Secretion Chaperone 2008-01-15T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA The InvB protein is a promiscuous chaperone in the Type III Secretion system (T3S) that assists in the secretion of SipA, SopA, and SopE2 effector proteins. This chaperone binds to the secretion signal of selected proteins and maintains the N-terminus in an unfolded state for secretion by the T3S. The chaperone is critical in coordinating the timing and localization to the proper secretion mechanism and is vital in secreting heterologous proteins with this system. false false _98_ 0 2407 98 Not in stock false This part was not designed to be compatible with biobricks standard assembly false Dan Widmaier annotation1959603 1 invB range1959603 1 1 408 BBa_J64009_sequence 1 atgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_J64016_sequence 1 atgactaacataacactatccacccagcactacagaatccatagaagtgacgttgaaccagtaaaagaaaaaacaacggagaaggacatttttgcaaaaagtattactgccgttagaaatagctttatcagcctgtcgacgagtctgtcagatcgttttagcctgcatcaacaaacagacataccgactacccattttcatcgtgggaacgcttctgagggtagggcggtattaaccagtaaaactgttaaagattttatgctgcaaaagctcaatagtctggatatcaaaggtaatgcgagtaaagatccggcc BBa_J64038_sequence 1 ttaattaaggaaaagatctatgcaacatttggatatcgctgaattagttcgttccgcactggaagtaagtggttgcgatccttcattaattggaggaatagatagccattcaacaattgttctggatttatttgcattgccaagtatctgtatcagcgtcaaggacgatgatgtatggatctgggcgcaattgggtgctgacagcatggtggtattacaacagcgggcttatgaaatcttaatgaccataatggaaggatgccattttgcccgcggcgggcaattactactgggggagcagaatggggagctaacgcttaaagccttagtgcatccggattttttatctgacggtgaaaagttctctactgccttgaatgggttttacaactatctggaagtttttagtcggtcgctaatgagataaattaaagaggagaaaatgactaacataacactatccacccagcactacagaatccatagaagtgacgttgaaccagtaaaagaaaaaacaacggagaaggacatttttgcaaaaagtattactgccgttagaaatagctttatcagcctgtcgacgagtctgtcagatcgttttagcctgcatcaacaaacagacataccgactacccattttcatcgtgggaacgcttctgagggtagggcggtattaaccagtaaaactgttaaagattttatgctgcaaaagctcaatagtctggatatcaaaggtaatgcgagtaaagatccggcc BBa_J64011_sequence 1 ttaattaaggaaaagatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z