BBa_J64017 1 BBa_J64017 invJ Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 15 amino acid secretion signal for the InvJ protein in the Salmonella Type III Secretion System. This signal when fused to a protein of interest will direct the chimeric protein to the secretion apparatus and into the extracellular environment. It should be noted that while this tag is very short it does not require a cognate chaperone. However, although no complex has been observed in the literature secretion cannot occur without the co-expression of the invI protein (BBa_J64019). false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. false Dan Widmaier annotation1959616 1 InvJ secretion signal range1959616 1 1 45 BBa_J64018 1 BBa_J64018 invJ RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA This part is the natural RBS associated with the invJ protein in Salmonella Typhimurium LT2. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959617 1 invJ RBS range1959617 1 1 17 BBa_J64039 1 BBa_J64039 invIJ Tag-coexpression 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z These parts are derived from Salmonella LT2 Genomic DNA This is a variant of the pCASP secretion circuit with the invJ secretion signal and invI co-expression false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly compatibility in mind, it might contain scar sequence cutsites. false Dan Widmaier component1960360 1 BBa_J64018 component1960362 1 BBa_J64017 component1960356 1 BBa_J64020 component1960358 1 BBa_J64019 annotation1960358 1 BBa_J64019 range1960358 1 21 446 annotation1960356 1 BBa_J64020 range1960356 1 1 20 annotation1960362 1 BBa_J64017 range1960362 1 464 508 annotation1960360 1 BBa_J64018 range1960360 1 447 463 BBa_J64020 1 BBa_J64020 invI RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA This part is the natural invI RBS from Salmonella Typhimurium LT2. false false _98_ 0 2407 98 Not in stock false This part was not designed with consideration for biobrick standard assembly in mind. This RBS has not been explicitly tested for expression level in a fluorescence or B-Gal assay. false Dan Widmaier annotation1959619 1 invI RBS range1959619 1 1 20 BBa_J64019 1 BBa_J64019 invI SPI-1 Protein 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA This part is the invI protein from the Salmonella Type III Secretion System. This part is a required co-expressed protein with the invJ secretion tag (BBa_J6017) to allow for expression and secretion. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobrick standard assembly in mind. false Dan Widmaier annotation1959618 1 invI range1959618 1 1 426 BBa_J64039_sequence 1 tgacacgttgagcggtatgaatgcattcgctgaccagaattaaagtattgcagcggcgctgtacggtatttcattcacagtgtgagtcgatattacttcgctatcaggatgaggaccgcgggctgcaggccgaggaggaggcgatccttgaacaaatagcgggtctgaaattgttattagatacgctgcgtgcagaaaacagacagctcagtcgtgaggaaatttatacgttattacgtaagcagtctattgttcgccggcagataaaagatttagaactccagattatacaaattcaggaaaaacggagcgagctggaaaagaaaagggaagagtttcagaaaaaaagtaaatattggttgcgcaaagaagggaactatcaacgctggataatccgtcagaaaagattctatatccagcgagagatacagcaggaagaggccgagtcagaggagataatttaatgggcgatgtgtcagctgtcagttcatccgggaacattttactg BBa_J64018_sequence 1 tcagaggagataattta BBa_J64020_sequence 1 tgacacgttgagcggtatga BBa_J64019_sequence 1 atgcattcgctgaccagaattaaagtattgcagcggcgctgtacggtatttcattcacagtgtgagtcgatattacttcgctatcaggatgaggaccgcgggctgcaggccgaggaggaggcgatccttgaacaaatagcgggtctgaaattgttattagatacgctgcgtgcagaaaacagacagctcagtcgtgaggaaatttatacgttattacgtaagcagtctattgttcgccggcagataaaagatttagaactccagattatacaaattcaggaaaaacggagcgagctggaaaagaaaagggaagagtttcagaaaaaaagtaaatattggttgcgcaaagaagggaactatcaacgctggataatccgtcagaaaagattctatatccagcgagagatacagcaggaagaggccgag BBa_J64017_sequence 1 atgggcgatgtgtcagctgtcagttcatccgggaacattttactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z