BBa_J64022 1 BBa_J64022 sicA RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS from the sicA chaperone (BBa_J6021) in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with standard biobrick assembly in mind. false Dan Widmaier annotation1959621 1 misc range1959621 1 1 20 BBa_J64023 1 BBa_J64023 sipC Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 167 amino acid secretion signal for the sipC protein in the Salmonella Type III Secretion System. This secretion signal can be fused to proteins of interest and will direct secretion to the extracellular space via the type III secretion apparatus. For secretion at high titer co-expression of the sicA chaperone protein (BBa_J64021) is required. false false _98_ 0 2407 98 Not in stock false This part was not designed with compliance to biobricks standard assembly in mind. false Dan Widmaier annotation1959622 1 sipC Secretion Signal range1959622 1 1 363 BBa_J64040 1 BBa_J64040 sicA Chaperone sipC Tag 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z This part is comprised of parts taken from Salmonella LT2 Genomic DNA This is a variant of the pCASP secretion circuit with the sicA chaperone and the sipC secretion signal. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly compatibility in mind, it might contain scar sequence cutsites. false Dan Widmaier component1960364 1 BBa_J64022 component1960366 1 BBa_J64021 component1960370 1 BBa_J64023 component1960368 1 BBa_J64024 annotation1960370 1 BBa_J64023 range1960370 1 534 896 annotation1960364 1 BBa_J64022 range1960364 1 1 20 annotation1960368 1 BBa_J64024 range1960368 1 519 533 annotation1960366 1 BBa_J64021 range1960366 1 21 518 BBa_J64024 1 BBa_J64024 sipC RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the natural RBS from the sipC protein in Salmonella Type III Secretion. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly in mind. This RBS has not been explicitly measured for expression rate using fluorescence or B-Gal assay. false Dan Widmaier annotation1959623 1 sipC RBS range1959623 1 1 15 BBa_J64021 1 BBa_J64021 sicA Chaperone 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella Typhimurium LT2 Genomic DNA. This part is a secretion chaperone from the Salmonella Type III Secretion System (T3S). SicA is required for secretion of sipC protein or sipC tagged heterologous proteins. SicA also functions as a component of a positive feedback loop involving the sicA promoter and invF. For more information see Temme et al in the reference section. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly in mind. false Dan Widmaier annotation1959620 1 sicA range1959620 1 1 498 BBa_J64040_sequence 1 acagataacaggagtaagtaatggattatcaaaataatgtcagcgaagaacgtgttgcggaaatgatttgggatgccgttagtgaaggcgccacgctaaaagacgttcatgggatccctcaagatatgatggacggtttatatgctcatgcttatgagttttataaccagggacgactggatgaagctgagacgttctttcgtttcttatgcatttatgatttttacaatcccgattacaccatgggactggcggcagtatgccaactgaaaaaacaatttcagaaagcatgtgacctttatgcagtagcgtttacgttacttaaaaatgattatcgccccgttttttttaccgggcagtgtcaattattaatgcgtaaggcagcaaaagccagacagtgttttgaacttgtcaatgaacgtactgaagatgagtctctgcgggcaaaagcgttggtctatctggaggcgctaaaaacggcggagacagagcagcacagtgaacaagaaaaggaataataaagggagaaaaatatgttaattagtaatgtgggaataaatcccgccgcttatttaaataatcattctgttgagaatagttcacagacagcttcgcaatccgttagcgctaaagatattctgaatagtattggtattagcagcagtaaagtcagtgacctggggttgagtcctacactgagcgcgcctgcgccaggggtattaacgcaaacccccggaacgatcacgtcctttttaaaagccagtattcaaaataccgacatgaatcaggatttgaatgctctggcaaataatgtcacgactaaagcgaatgaggttgtgcaaacccagttacgcgagcagcaggcagaagtcggaaagttttttgatattagcgga BBa_J64024_sequence 1 taaagggagaaaaat BBa_J64021_sequence 1 atggattatcaaaataatgtcagcgaagaacgtgttgcggaaatgatttgggatgccgttagtgaaggcgccacgctaaaagacgttcatgggatccctcaagatatgatggacggtttatatgctcatgcttatgagttttataaccagggacgactggatgaagctgagacgttctttcgtttcttatgcatttatgatttttacaatcccgattacaccatgggactggcggcagtatgccaactgaaaaaacaatttcagaaagcatgtgacctttatgcagtagcgtttacgttacttaaaaatgattatcgccccgttttttttaccgggcagtgtcaattattaatgcgtaaggcagcaaaagccagacagtgttttgaacttgtcaatgaacgtactgaagatgagtctctgcgggcaaaagcgttggtctatctggaggcgctaaaaacggcggagacagagcagcacagtgaacaagaaaaggaataa BBa_J64023_sequence 1 atgttaattagtaatgtgggaataaatcccgccgcttatttaaataatcattctgttgagaatagttcacagacagcttcgcaatccgttagcgctaaagatattctgaatagtattggtattagcagcagtaaagtcagtgacctggggttgagtcctacactgagcgcgcctgcgccaggggtattaacgcaaacccccggaacgatcacgtcctttttaaaagccagtattcaaaataccgacatgaatcaggatttgaatgctctggcaaataatgtcacgactaaagcgaatgaggttgtgcaaacccagttacgcgagcagcaggcagaagtcggaaagttttttgatattagcgga BBa_J64022_sequence 1 acagataacaggagtaagta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z