BBa_J64027 1 BBa_J64027 sopB Secretion Signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part consists of the 168 amino acid secretion signal of sopB in the Salmonella Type III Secretion System (T3S). When fused to a protein of interest this signal, when co-expressed with the cognate chaperone sigE (BBa_J64025), will be directed to the T3S secretion apparatus for export to the extracellular environment. The co-expression of the chaperone is critical for high titers of secreted protein. false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. false Dan Widmaier annotation1959626 1 sopB secretion signal range1959626 1 1 504 BBa_J64026 1 BBa_J64026 sigE RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS for the sigE chaperone (BBa_J64025) in Salmonella Typhimurium LT2. false false _98_ 0 2407 98 Not in stock false This part was not designed with compatibility to biobrick standard assembly in mind. This RBS has not been explicitly assayed for expression rate. false Dan Widmaier annotation1959625 1 sigE RBS range1959625 1 1 18 BBa_J64028 1 BBa_J64028 sopB RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the natural RBS for the sopB gene in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with consideration for biobrick standard assembly in mind. This RBS hasn't been explicitly tested for expression rate in a Fluorescence or B-Gal assay. false Dan Widmaier annotation1959632 1 sopB RBS range1959632 1 1 20 BBa_J64025 1 BBa_J64025 sigE Secretion Chaperone 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is a cognate secretion chaperone for the sopB secretion signal in the Salmonella Type III Secretion System. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly in mind. false Dan Widmaier annotation1959624 1 sigE Chaperone range1959624 1 1 342 BBa_J64041 1 BBa_J64041 sigE Chaperone sopB Tag 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z Salmonella LT2 Genomic DNA This is a variant of the pCASP secretion circuit with the sigE chaperone and sopB secretion signal. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly compatibility in mind, it might contain scar sequence cutsites. false Dan Widmaier component1960376 1 BBa_J64028 component1960378 1 BBa_J64027 component1960372 1 BBa_J64026 component1960374 1 BBa_J64025 annotation1960374 1 BBa_J64025 range1960374 1 19 360 annotation1960378 1 BBa_J64027 range1960378 1 381 884 annotation1960372 1 BBa_J64026 range1960372 1 1 18 annotation1960376 1 BBa_J64028 range1960376 1 361 380 BBa_J64041_sequence 1 gagtcttgaggtaactatatggaaagtctattaaatcgtttatatgacgcgttaggcctggatgcgccagaagatgagccactgcttatcattgatgatgggatacaggtttattttaatgaatccgatcatacactggaaatgtgctgtccctttatgccattgcctgacgacatcctgactttgcagcattttttacgtctgaactacaccagcgccgtcactatcggcgctgacgcagacaatactgctttagtggcgctttatcgcttgccgcaaaccagtaccgaagaagaggcgctcactggttttgaattattcatttcaaacgtgaagcaattgaaagagcattatgcataatcaggaatattaaaaacgctatgcaaatacagagcttctatcactcagcttcactaaaaacccaggaggcttttaaaagcctacaaaaaaccttatacaacggaatgcagattctctcaggccagggcaaagcgccggctaaagcgcccgacgctcgcccggaaattattgtcctgcgagaacccggcgcgacatgggggaattatctacagcatcagaaggcgtctaaccactcgctgcataacctctataacttacagcgcgatcttcttaccgtcgcggcaaccgttctgggtaaacaagacccggttctaacgtcaatggcaaaccaaatggagttagccaaagttaaagcggaccggccagcaacaaaacaagaagaagccgcggcaaaagcattgaagaaaaatcttatcgaacttattgcagcacgcactcagcagcaggatggcttacctgcaaaagaagctcatcgctttgcggcagtagcgtttagagatgctcaggtcaagcagcttaataac BBa_J64027_sequence 1 atgcaaatacagagcttctatcactcagcttcactaaaaacccaggaggcttttaaaagcctacaaaaaaccttatacaacggaatgcagattctctcaggccagggcaaagcgccggctaaagcgcccgacgctcgcccggaaattattgtcctgcgagaacccggcgcgacatgggggaattatctacagcatcagaaggcgtctaaccactcgctgcataacctctataacttacagcgcgatcttcttaccgtcgcggcaaccgttctgggtaaacaagacccggttctaacgtcaatggcaaaccaaatggagttagccaaagttaaagcggaccggccagcaacaaaacaagaagaagccgcggcaaaagcattgaagaaaaatcttatcgaacttattgcagcacgcactcagcagcaggatggcttacctgcaaaagaagctcatcgctttgcggcagtagcgtttagagatgctcaggtcaagcagcttaataac BBa_J64025_sequence 1 atggaaagtctattaaatcgtttatatgacgcgttaggcctggatgcgccagaagatgagccactgcttatcattgatgatgggatacaggtttattttaatgaatccgatcatacactggaaatgtgctgtccctttatgccattgcctgacgacatcctgactttgcagcattttttacgtctgaactacaccagcgccgtcactatcggcgctgacgcagacaatactgctttagtggcgctttatcgcttgccgcaaaccagtaccgaagaagaggcgctcactggttttgaattattcatttcaaacgtgaagcaattgaaagagcattatgcataa BBa_J64028_sequence 1 tcaggaatattaaaaacgct BBa_J64026_sequence 1 gagtcttgaggtaactat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z