BBa_J64029 1 BBa_J64029 sopD secretion signal 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This part is the 40 amino acid secretion signal for the sopD protein in Salmonella Type III Secretion. This signal works without the co-expression of a cognate secretion chaperone. false false _98_ 0 2407 98 Not in stock false This part was not designed with consideration for biobrick standard assembly in mind. false Dan Widmaier annotation1959633 1 sopD secretion signal range1959633 1 1 120 BBa_J64042 1 BBa_J64042 sopD Tag pCASP 2008-01-16T12:00:00Z 2015-05-08T01:08:16Z Salmonella LT2 Genomic DNA This is a variant of the pCASP secretion circuit with no chaperone and the sopD secretion signal. false false _98_ 0 2407 98 Not in stock false This part was not designed with biobrick standard assembly compatibility in mind, it might contain scar sequence cutsites. false Dan Widmaier component1960382 1 BBa_J64029 component1960380 1 BBa_J64030 annotation1960382 1 BBa_J64029 range1960382 1 18 137 annotation1960380 1 BBa_J64030 range1960380 1 1 17 BBa_J64030 1 BBa_J64030 sopD RBS 2008-01-16T12:00:00Z 2015-08-31T01:56:26Z Salmonella LT2 Genomic DNA This is the natural RBS from the sopD gene in Salmonella Type III Secretion. false false _98_ 0 2407 98 Not in stock false This part was designed without consideration for biobrick standard assembly. This RBS has not been explicitly tested for expression rate. false Dan Widmaier annotation1959634 1 sopD RBS range1959634 1 1 17 BBa_J64029_sequence 1 atgccagtcactttaagcttcggtaatcatcaaaattatacgcttaatgaaagtcggcttgctcatctgttaagcgcagataaagaaaaagcaatccatatggggggttgggataaagtc BBa_J64030_sequence 1 atttgaaggaaaatatt BBa_J64042_sequence 1 atttgaaggaaaatattatgccagtcactttaagcttcggtaatcatcaaaattatacgcttaatgaaagtcggcttgctcatctgttaagcgcagataaagaaaaagcaatccatatggggggttgggataaagtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z