BBa_J64043 1 BBa_J64043 T1 terminator 2008-01-21T12:00:00Z 2015-05-08T01:08:16Z Commercial plasmid DNA This is the T1 terminator from the pPROTet 6xHN vector commercially available from Clontech. false false _98_ 0 2407 98 Not in stock false This sequence is not designed with biobrick standard assembly compatibility in mind. false Dan Widmaier annotation1960020 1 T1 Terminator range1960020 1 1 105 BBa_J64043_sequence 1 ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z