BBa_J64065 1 BBa_J64065 cI repressed promoter 2007-05-12T11:00:00Z 2015-05-08T01:08:16Z J23119 + R0065 This is a LuxR-30C6HSL-independent version of R0065. All DNA upstream of the -10 box is from the constitutive promoter J23119. All DNA downstream from the -10 box down is from R0065. This results in the replacement of the Lux box region for a constitutive promoter region and the maintenance of the two cI operators downstream of the transcription start site. false false _98_ 0 88 98 Not in stock false none false Jeffrey J Tabor annotation1932684 1 OR2 range1932684 1 58 74 annotation1932681 1 -35 range1932681 1 1 6 annotation1932682 1 -10 range1932682 1 24 29 annotation1932685 1 +1 range1932685 1 35 35 annotation1932683 1 OR1 range1932683 1 34 51 BBa_J64065_sequence 1 ttgacagctagctcagtcctaggtatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z