BBa_J64066 1 BBa_J64066 increased strength R0051 (constitutive) 2007-12-11T12:00:00Z 2015-05-08T01:08:16Z Redesigned based on BBa_R0051 This promoter is a variant of BBa_R0051 containing the extended -10 sequence 5'-TRTG-3' 1 nucleotide upstream of the -10 hexamer. This promoter should produce more POPS than R0051 in the absence of CI protein while producing similarly few POPS in it's presence. true false _98_ 0 88 98 Discontinued false see above false Jeffrey J Tabor annotation1959016 1 extended -10 range1959016 1 33 36 annotation1959017 1 -10 range1959017 1 38 43 annotation1959015 1 -35 range1959015 1 15 20 annotation1959014 1 OR2 range1959014 1 1 19 BBa_J64066_sequence 1 taacaccgtgcgtgttgactattttacctctgtgtgtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z