BBa_J64609 1 creD RBS creD RBS 2007-03-19T12:00:00Z 2015-05-08T01:08:17Z E Coli Strain K12 The ribosomal binding site of the creD gene in the E Coli creD operon. false false _98_ 0 1422 98 Not in stock false natural sequence, no design. false Ryan Ritterson BBa_J64609_sequence 1 tgccattgcaaaggagaagact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z