BBa_J64712 1 BBa_J64712 LasR/LasI Inducible & RHLR/RHLI repressible Promoter 2007-03-24T12:00:00Z 2015-05-08T01:08:17Z Rust L. et. al., "Analysis of the Pseudomonas aeruginosa Elastase (lasB) Regulatory Region". Journal of Bacteriology, 1996. This part is similar to BBa_R0079 but has an added binding site for RHLR/RHLI in between the -35 and -10 region. Thus this promoter is induced by LasR/LasI but repressed by RHLR/RHLI binding. false false _98_ 0 1431 98 Not in stock false The natural spacer between the -35 and -10 is 14bp and the natural O1 site for RHLR/RHLI is 20bp long. There was not much over lap of the -35 or the -10 with this sequence, so it was nessicary to chop off some of the binding site sequence in order to maintain the correct spacing and preserve the -35 and -10 sequence. The binding site sequence is missing a tcc on is 5' end and a t on its 3' end. false laura lavery annotation1921066 1 RHLR/RHLI range1921066 1 125 141 annotation1921068 1 -10 range1921068 1 140 145 annotation1921067 1 -35 range1921067 1 117 122 annotation1921065 1 LasR/LasI O1 range1921065 1 106 125 annotation1921064 1 LasR/LasI O2 range1921064 1 46 64 BBa_J64712_sequence 1 gcccctcgctgagcgcgtcccggagctgggggcaacctagctgccacctgcttttctgctagctattccagcgaaaacatacagatttccggcgaaatcaaggctacctgccagttctggcaggtgtgaaatctggcagtttttggtacacgaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z