BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2023 1 -35 range2023 1 15 20 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 annotation2024 1 OR1 range2024 1 25 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0179 1 lasR lasR activator from P. aeruginosa PAO1(no LVA) 2004-05-26T11:00:00Z 2015-08-31T04:07:24Z Released HQ 2013 same as C0079 except no LVA tag false false _11_1_ 0 61 7 In stock false true jcbraff BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J64715 1 BBa_J64715 Constituive expression of LasR 2007-03-25T12:00:00Z 2015-05-08T01:08:17Z Registry parts In the absence of CI this strong promoter expresses LasR. false false _98_ 0 1431 98 Not in stock false project goal false laura lavery component1921462 1 BBa_B0010 component1921455 1 BBa_R0051 component1921464 1 BBa_B0012 component1921460 1 BBa_B0034 component1921461 1 BBa_C0179 annotation1921461 1 BBa_C0179 range1921461 1 76 798 annotation1921455 1 BBa_R0051 range1921455 1 1 49 annotation1921460 1 BBa_B0034 range1921460 1 58 69 annotation1921462 1 BBa_B0010 range1921462 1 807 886 annotation1921464 1 BBa_B0012 range1921464 1 895 935 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0179_sequence 1 atggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaggactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctctaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J64715_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaggactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctctaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z