BBa_J64750 1 BBa_J64750 SPI-1 TTSS secretion-linked promoter from <I>Salmonella</I> 2007-05-14T11:00:00Z 2015-05-08T01:08:17Z This part was cloned from Salmonella typhimurium 1344 genomic DNA. This promoter is activated when functional SPI-1 type III secretion systems are present and functional in Salmonella typhimurium 1344. false false _98_ 0 88 98 Not in stock false The promoter includes the binding site for the transcription factor InvF. This transcription factor is activated by the SicA chaparone when the secretion system is active. false Jeffrey J Tabor annotation1932769 1 start range1932769 1 165 167 annotation1932768 1 wt rbs range1932768 1 153 158 BBa_J64750_sequence 1 ccacaagaaaacgaggtacggcattgagccgcgtaaggcagtagcgatgtattcattgggcgttttttgaatgttcactaaccaccgtcggggtttaataactgcatcagataaacgcagtcgttaagttctacaaagtcggtgacagataacaggagtaagtaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z