BBa_J64804 1 BBa_J64804 The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon 2007-03-19T12:00:00Z 2015-05-08T01:08:17Z Information was obtained from: http://dbtbs.hgc.jp/COG/prom/rocDEF.html. This is the reported promoter region from the Bacillus subtilis RocDEF operon as taken from the DBTBS website (http://dbtbs.hgc.jp/). Base 1 to base 21 contains the binding site for the binding factor, RocR. The sequence, TATGCAAAAGAATTTTGCACT, reportedly contains the consensus sequence for binding of this factor. Base 42 to base 62 contains another binding site for the RocR binding factor, with ATATCAGAATGTTTTTGCACC as the binding consensus for this sequence. Bases 113-135 outline the binding site of the binding factor AhrC (CTTGCATTTATATAAAGGGAAAG). Bases 96 to 135 outline the promoter region for this operon (CTTGATTTGGCACAGAACTTGCATTTATATAAAGGGAAAG). false false _98_ 0 1428 98 Not in stock false This sequence only outlines the reported promoter region as ascertained from the online resource described above, and may lack nucleotides not described by the operon analysis used. false Sai Duriseti annotation1920952 1 RocR Binding Site range1920952 1 42 62 annotation1920953 1 Promoter range1920953 1 96 135 annotation1920951 1 RocR Binding Site range1920951 1 1 21 annotation1920955 1 AhrC range1920955 1 113 131 BBa_J64804_sequence 1 tatgcaaaagaattttgcacttgctgaaattttcgctcgaaatatcagaatgtttttgcaccttgtcctcgaaaattgtagaaaacacacgaattcttgatttggcacagaacttgcatttatataaagggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z