BBa_J64907 1 creA RBS creA RBS 2007-03-19T12:00:00Z 2015-05-08T01:08:17Z E Coli strain K12 ribosome binding site for creA gene in the E Coli cre operon false false _98_ 0 1422 98 Not in stock false natural sequence, no design. false Ryan Ritterson BBa_J64907_sequence 1 atagataaaaatggtaacaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z