BBa_J64908 1 creC RBS RBS for creC in e coli operon 2007-03-19T12:00:00Z 2015-05-08T01:08:17Z E Coli K12 strain. The ribosomal binding site for gene creC in the E Coli cre operon. false false _98_ 0 1422 98 Not in stock false natural sequence, no design false Ryan Ritterson BBa_J64908_sequence 1 gggatatagcctgaggggcctgta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z