BBa_E0022 1 ECFP enhanced cyan fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0021</bb_part>. Released HQ 2013 Cyan fluorescent protein (ECFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0022 cyan fluorescent protein is based on BioBrick part BBa_E0021. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2155 1 A range2155 1 69 69 annotation7040 1 BBa_E0022 range7040 1 1 762 annotation2153 1 SsrA range2153 1 719 756 annotation2150 1 CFP (LVA) range2150 1 1 762 annotation2154 1 2 range2154 1 757 762 BBa_J64723 1 BBa_J64723 crR12 lock 2007-03-20T12:00:00Z 2015-05-08T01:08:17Z dljk ksfldj false false _98_ 0 1425 98 Not in stock false dfsl false Sheel Dandekar BBa_I14032 1 P(Lac) IQ promoter P(Lac) IQ 2004-08-03T11:00:00Z 2015-08-31T04:07:37Z Plasmid pMAL-p2X Released HQ 2013 Constitutive Promoter, High Transcription false true _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1028344 1 -10 range1028344 1 26 31 annotation1028343 1 -35 range1028343 1 3 8 annotation1028342 1 P(Lac) IQ range1028342 1 1 37 BBa_J64974 1 BBa_J64974 small molecule controlled, riboregulator based XOR gate 2007-03-20T12:00:00Z 2015-05-08T01:08:17Z The Collins lab riboregulators and existing registry parts. This device uses the small molecules lac and tet as inputs and expresses GFP as an XOR function of the two. false false _98_ 0 1432 98 Not in stock false The presence of either (but not both) of the keys unlocks a blocked RBS to allow translation of a CFP degradation tag fusion. The two keys have a greater affinity to each other than to the lock, so the presence of both does not unlock the blocked RBS. false reid williams component1921345 1 BBa_E0022 component1921351 1 BBa_B0012 component1921331 1 BBa_R0040 component1921336 1 BBa_B0010 component1921343 1 BBa_J64723 component1921323 1 BBa_J64720 component1921349 1 BBa_B0010 component1921322 1 BBa_I14032 component1921324 1 BBa_B0010 component1921326 1 BBa_B0012 component1921335 1 BBa_J64722 component1921338 1 BBa_B0012 component1921342 1 BBa_J23100 annotation1921338 1 BBa_B0012 range1921338 1 557 597 annotation1921323 1 BBa_J64720 range1921323 1 46 149 annotation1921349 1 BBa_B0010 range1921349 1 1477 1556 annotation1921351 1 BBa_B0012 range1921351 1 1565 1605 annotation1921336 1 BBa_B0010 range1921336 1 469 548 annotation1921331 1 BBa_R0040 range1921331 1 295 348 annotation1921343 1 BBa_J64723 range1921343 1 649 700 annotation1921324 1 BBa_B0010 range1921324 1 158 237 annotation1921345 1 BBa_E0022 range1921345 1 707 1468 annotation1921322 1 BBa_I14032 range1921322 1 1 37 annotation1921342 1 BBa_J23100 range1921342 1 606 640 annotation1921335 1 BBa_J64722 range1921335 1 357 460 annotation1921326 1 BBa_B0012 range1921326 1 246 286 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J64720 1 BBa_J64720 taR12 prime key 2007-03-20T12:00:00Z 2015-05-08T01:08:17Z dfjls dlfa false false _98_ 0 1425 98 Not in stock false dsjkl false Sheel Dandekar BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J64722 1 BBa_J64722 taR12 key 2007-03-20T12:00:00Z 2015-05-08T01:08:17Z sadfl dsf; false false _98_ 0 1425 98 Not in stock false sdjaf false Sheel Dandekar BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J64974_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcctactagagcggcgacaggagcctctagagatatatggtatagtaagttaattttcattaaccaccaacccaaatccaggaggtgattggtagaccctagcgatgctcgaacctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagggttcgagcatcgctagggtacccaaatccaggaggtgattggtagtggtggttaatgaaaattaacttactataccatatatctctagaggctcctgtcgccgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgacggctagctcagtcctaggtacagtgctagctactagaggaattctaccattcacctcttggatttgggtattaaagaggagaaaggtacctactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I14032_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J64720_sequence 1 cggcgacaggagcctctagagatatatggtatagtaagttaattttcattaaccaccaacccaaatccaggaggtgattggtagaccctagcgatgctcgaacc BBa_E0022_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_J64723_sequence 1 gaattctaccattcacctcttggatttgggtattaaagaggagaaaggtacc BBa_J64722_sequence 1 ggttcgagcatcgctagggtacccaaatccaggaggtgattggtagtggtggttaatgaaaattaacttactataccatatatctctagaggctcctgtcgccg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z